First flight in the world of a privately owned MiG-29

General » General Discussion

[ARCHIVED THREAD] - First flight in the world of a privately owned MiG-29 (Page 1 of 2)

Posted: 12/15/2010 11:49:47 AM EDT

Posted: 12/15/2010 11:52:07 AM EDT

[#1]

Cool.

Is it owned by a rich individual, or a company that contracts with the .mil to play the bad guy role in training exercises?

Posted: 12/15/2010 11:52:34 AM EDT

[#2]

Cool, but video is anticlimactic.

Posted: 12/15/2010 11:54:12 AM EDT

[#3]

where's the weapons attachments? FAIL!!!

Posted: 12/15/2010 11:54:48 AM EDT

[#4]

I've got family out there. Don Kirlin has some cool toys.

Posted: 12/15/2010 11:55:19 AM EDT

[#5]

Where's the spinning horizon and ejection?

Posted: 12/15/2010 11:56:46 AM EDT

[#6]

I didn't know those could land on wheels

Posted: 12/15/2010 11:57:42 AM EDT

[#7]

Group buy?

Posted: 12/15/2010 11:59:21 AM EDT

[#8]

and I thought firearms was an expensive hobby

Posted: 12/15/2010 12:01:14 PM EDT

[#9]

He skeeted champagne right on her butt...

Posted: 12/15/2010 12:01:37 PM EDT

[#10]

not a bad looking bird.

Posted: 12/15/2010 12:04:07 PM EDT

[#11]

Quoted:
Cool, but video is anticlimactic.

What? You didn't enjoy the "money shot" to Natasha's backside?

Posted: 12/15/2010 12:04:45 PM EDT

[#12]

I'm surprised more billionaires don't have toys like this.

Posted: 12/15/2010 12:05:58 PM EDT

[#13]

Pretty cool. Can't really one up that one. I own a mig bitch.

Posted: 12/15/2010 12:06:55 PM EDT

[#14]

I bet insurance is a motherfucker on that

Posted: 12/15/2010 12:08:05 PM EDT

[#15]

America, FUCK YEA!

not only will we kill you in your sleep on Chrismas, well take your best fighters and sell them to our citizens

Posted: 12/15/2010 12:08:25 PM EDT

[#16]

Quoted:

I bet insurance is a motherfucker on that

only at airshows

Posted: 12/15/2010 12:11:06 PM EDT

[#17]

He didn't even change the markings; that should turn a few ex-military pilot's heads. I wonder if he has to file any special flight plans to fly it?

Posted: 12/15/2010 12:11:07 PM EDT

[#18]

Quoted:
Where's the spinning horizon and ejection?

It wasn't an air show.

Posted: 12/15/2010 12:11:41 PM EDT

[#19]

Quoted:
I didn't know those could land on wheels

Posted: 12/15/2010 12:12:45 PM EDT

[#20]

I believe two Private Su-27's have already flown and they are much higher performance bird.

Posted: 12/15/2010 12:16:31 PM EDT

[#21]

Quoted:

He skeeted champagne right on her butt...

First thing that came to mind when I saw the "money shot".

Posted: 12/15/2010 12:27:46 PM EDT

[#22]

What a waste of a back seat.

Posted: 12/15/2010 12:29:13 PM EDT

[#23]

Needs smokeless engines, other than that it's cool as hell.

Posted: 12/15/2010 12:34:29 PM EDT

[#24]

That's cool.

Here's the company: http://www.redair.net/

Posted: 12/15/2010 12:34:31 PM EDT

[#25]

Absolutely gorgeous aircraft.

Posted: 12/15/2010 12:34:42 PM EDT

[#26]

wow

Posted: 12/15/2010 12:42:05 PM EDT

[#27]

I was waiting for him to go vertical right after takeoff, but I guess he has to fly it somewhat civilized (FAA).

Posted: 12/15/2010 12:43:34 PM EDT

[#28]

Damn, that's pretty freakin cool...

Posted: 12/15/2010 12:46:43 PM EDT

[#29]

Damn can he get a regular supply of vacuum tubes to keep it flying?

Posted: 12/15/2010 12:49:16 PM EDT

[#30]

Now, that looks fun.....

Posted: 12/15/2010 12:50:19 PM EDT

[#31]

Quoted:

Damn can he get a regular supply of vacuum tubes to keep it flying?

In Soviet Russia mig, mig makes own vacuum tubes.

Posted: 12/15/2010 12:54:01 PM EDT

[#32]

Quoted:
I'm surprised more billionaires don't have toys like this.

You think someone like Bill Gates could affort it, and a couple guys to maintain it. Though it'd be pricey, it'd be like us paying an extra $50 a month for something.

Posted: 12/15/2010 12:54:58 PM EDT

[#33]

sure would love to take a ride in this

Posted: 12/15/2010 12:55:36 PM EDT

[#34]

Quoted:
I didn't know those could land on wheels

Posted: 12/15/2010 1:06:10 PM EDT

[#35]

I'm lamenting.

Posted: 12/15/2010 1:07:46 PM EDT

[#36]

I have family in that area. The stories of how Kirlin got some of his MIGs are pretty awesome.

Posted: 12/15/2010 1:08:29 PM EDT

[#37]

If memory serves me right, dod didn't require him to take off ALL the fun stuff :)

Posted: 12/15/2010 1:16:12 PM EDT

[#38]

Posted: 12/15/2010 1:21:49 PM EDT

[#39]

DO want!

Posted: 12/15/2010 1:23:43 PM EDT

[#40]

Nice.

I bet it is bought by the same people who bought the former Ukrainian Su-27.

Hopefully they will be used for some cool fictional Cold War movies. It would look far more authentic than computer generated stuff.

And then film those privately owned F-18s fighting them.

Posted: 12/15/2010 1:29:51 PM EDT

[#41]

SHould be easy to pick up spare parts from the Ukraine with the help of the DOD; since these are used for OPFOR training. Now our guys in both the USN and USAF have a real Mig to shoot at instead of repainted F-16s aqnd F-18s.

Posted: 12/15/2010 1:33:59 PM EDT

[#42]

Quoted:
SHould be easy to pick up spare parts from the Ukraine with the help of the DOD; since these are used for OPFOR training. Now our guys in both the USN and USAF have a real Mig to shoot at instead of repainted F-16s aqnd F-18s.

We use to use German MIG-29s.

I believe we also used to use MIG-23s to.

Posted: 12/15/2010 1:36:56 PM EDT

[#43]

Beautiful bird. Great turn and burn fighter. He should have some fun with it.

Posted: 12/15/2010 1:39:52 PM EDT

[#44]

#2 was smoking.

Needs moar USAF markings.

Posted: 12/15/2010 1:41:48 PM EDT

[#45]

What are the regs on going supersonic?

Posted: 12/15/2010 1:44:27 PM EDT

[#46]

I hope he's proficient in the ejection sequence.

Posted: 12/15/2010 1:47:34 PM EDT

[#47]

Does the same dude the A-4 that was the chase plane?

Posted: 12/15/2010 1:50:42 PM EDT

[#48]

tagtagtagtagtagtagtagtagtagtagtagtagtagtag

Posted: 12/15/2010 1:52:31 PM EDT

[#49]

Quoted:
Does the same dude the A-4 that was the chase plane?

That's not an A-4.

ETA: That is an L-59 or an L-39.

Posted: 12/15/2010 1:53:50 PM EDT

[#50]

Quoted:

Does the same dude the A-4 that was the chase plane?

no an A-4 its a L-39

beat by 1.2 secs!!!

[ARCHIVED THREAD] - First flight in the world of a privately owned MiG-29 (Page 1 of 2)

General » General Discussion

Win a FREE Membership!

Sign up for the ARFCOM weekly newsletter and be entered to win a free ARFCOM membership. One new winner* is announced every week!

You will receive an email every Friday morning featuring the latest chatter from the hottest topics, breaking news surrounding legislation, as well as exclusive deals only available to ARFCOM email subscribers.

Warning

Confirm Action

About AR15.COM

Stay Connected

Newsletter

Contact Us